Ca2+/CaM Signaling Involved in Salicylic Acid-Induced Glycine Betaine Accumulation in Jatropha curcas L. under Osmotic Stress

doi:10.3969/j.issn.1000-2561.2020.05.013

Abstract

Abstract:

Hydroponic experiments were carried out to study the effect of exogenous salicylic acid (SA) on the content of glycine betaine (GB), the activity of the key enzyme betaine aldehyde dehydrogenase (BADH) of GB biosynthesis, and the expression of GB metabolism-related genes in the leaves of Jatropha curcas seedlings under PEG 6000 stress. Meanwhile, the effects of Ca ²⁺ and calmodulin (CaM) antagonists on SA-induced GB accumulation were investigated too. SA treatment significantly enhanced the content of GB, increased the activity of BADH, and improved the expression level of JcCMO and JcBADH in the leaves of J. curcas seedlings under osmotic stress. Interestingly, compared to the seedlings exposed to PEG treatment alone, SA treatment significantly increased the activity of CaM under osmotic stress. Calcium chloride (CaCl₂) treatment could promote SA-induced GB accumulation. It also induced an increase of BADH activity, and up-regulated JcBADH expression. The results indicate that exogenous SA treatment can enhance the biosynthesis of GB, and Ca ²⁺/CaM signaling might be involved in the regulation of SA-induced GB accumulation.

Key words: salicylic acid, osmotic stress, glycine betaine, Jatropha curcas L., Ca²⁺/CaM signaling

CLC Number:

S718.3

YANG Shuanglong,YANG Ting,GONG Ming. Ca²⁺/CaM Signaling Involved in Salicylic Acid-Induced Glycine Betaine Accumulation in Jatropha curcas L. under Osmotic Stress[J]. Chinese Journal of Tropical Crops, 2020, 41(5): 939-946.

Figures/Tables 9

Tab. 1 Experimental design of study

编号 Serial number	处理方式 Treatment	处理时间 Time of treatment/d
CK	1/2 Hoagland	0~4
PEG	1/2 Hoagland +20% PEG	0~4
SA1	1/2 Hoagland +20% PEG +1.5 mmol·L^-1 SA	0~4
SA2	1/2 Hoagland +20% PEG+1.5 mmol·L^-1 SA+10 mmol·L^-1 CaCl₂	2
SA3	1/2 Hoagland +20% PEG+1.5 mmol·L^-1 SA+500 μmol·L^-1 LaCl₃	2
SA4	1/2 Hoagland +20% PEG+1.5 mmol·L^-1 SA+200 μmol·L^-1 CPZ	2
SA5	1/2 Hoagland +20% PEG+1.5 mmol·L^-1 SA+200 μmol·L^-1 TFP	2

Tab. 2 Sequences of specific primers used for RT-qPCR analysis

基因名称 Gene name	登录号 Accession number of GenBank	引物序列 Sequence of primer (5°-3°)	扩增长度Amplicon size/bp
JcBADH	EF174190	F:CGTGAATTAGGAGAATGG R:TTGAAGGAGACTGATACC	100
JcCMO	XM_012219048	F:AAGCTTTGGCGTCTGGTCTT R:CCGACCAAAATCATCCGCAC	113
18S rRNA	AY823528	F:ACATAGTAAGGATTGACAGA R:TAACGGAATTAACCAGACA	103

Fig. 1 Effects of different SA concentrations on glycine betaine content in leaves of J. curcas seedlings under normal and osmotic stress conditions Different lowercase letters indicate significant difference between different treatments (P<0.05).

Fig. 2 Effect of exogenous SA treatment on glycine betaine content in leaves of J. curcas seedlings under osmotic stress Different lowercase letters indicate significant difference between different treatments (P<0.05).

Fig. 3 Effect of exogenous SA treatment on BADH activity in leaves of J. curcas seedlings under osmotic stress Different lowercase letters indicate significant difference between different treatments (P<0.05).

Fig. 4 Effect of exogenous SA treatment on expression of JcBADH (A) and JcCMO (B) genes in leaves of J. curcas seedlings under osmotic stress Different lowercase letters indicate significant difference between different treatments (P<0.05).

Fig. 5 Effect of exogenous SA treatment on CaM activity in leaves of J. curcas seedlings sunder osmotic stress Different lowercase letters indicate significant difference between different treatments (P<0.05).

Fig. 6 Effect of different treatments on glycine betaine content (A) and BADH activity (B) in leaves of J. curcas seedlings under osmotic stress Different lowercase letters indicate significant difference between different treatments (P<0.05).

Fig. 7 Effect of different treatments on expression of JcBADH (A) and JcCMO (B) genes in leaves of J. curcas seedlings under osmotic stress Different lowercase letters indicate significant difference between different treatments (P<0.05).

References 31

[1]	Ao P X, Li Z G, Gong M. Involvement of compatible solutes in chill hardening-induced chilling tolerance in Jatropha curcas seedlings[J]. Acta Physiologiae Plantarum, 2013,35(12):3457-3464.
[2]	Yang S L, Chen K, Wang S S, et al. Osmoregulation as a key factor in drought hardening-induced drought tolerance in Jatropha curcas[J]. Biologia Plantarum, 2015,59(3):529-536.
[3]	欧文军, 王文泉, 李开绵. 120份小桐子种质的分子遗传多样性分析[J]. 热带作物学报, 2009,30(3):284-292.
[4]	Montes J M, Melchinger A E. Domestication and breeding of Jatropha curcas L.[J]. Trends in Plant Science, 2016,21(12):1045-1057.
[5]	Maes W H A, Trabucco A, Achten W M J, et al . Climatic growing conditions of Jatropha curcas L.[J]. Biomass and Bioenergy, 2009,33(10):1481-1485.
[6]	Makkar H P S, Becker K. Jatropha curcas, a promising crop for the generation of biodiesel and value-added coproducts[J]. European Journal of Lipid Science and Technology, 2009,111(8):773-787.
[7]	Marcinska I, Czyczylo-Mysza I, Skrzypek E, et al. Impact of osmotic stress on physiological and biochemical characteristics in drought-susceptible and drought-resistant wheat genotypes[J]. Acta Physiologiae Plantarum, 2013,35(2):451-461.
[8]	Wu G Q, Feng R J, Shui Q Z. Effect of osmotic stress on growth and osmolytes accumulation in sugar beet (Beta vulgaris L.) plants[J]. Plant, Soil and Environment, 2016,62(4):189-194.
[9]	Khan M S, Yu X, Kikuchi A, et al. Genetic engineering of glycine betaine biosynjournal to enhance abiotic stress tolerance in plants[J]. Plant Biotechnology, 2009,26(1):125-134.
[10]	Chen, T H H, Murata N. Glycinebetaine: an effective protectant against abiotic stress in plants[J]. Trends in Plant Science, 2008,13(9):499-505.
[11]	Moghaieb R E A, Saneoka H, Fujita K. Effect of salinity on osmotic adjustment, glycinebetaine accumulation and the betaine aldehyde dehydrogenase gene expression in two halophytic plants, Salicornia europaea and Suaeda maritime[J]. Plant Science, 2004,166(5):1345-1349.
[12]	Chen T H H, Murata N. Glycinebetaine protects plants against abiotic stress: mechanisms and biotechnological applications[J]. Plant, Cell and Environment, 2011,34(1):1-20. DOI URL
[13]	Gao X P, Pan Q H, Li M J, et al. Abscisic acid is involved in the water stress-induced betaine accumulation in pear leaves[J]. Plant Cell Physiology, 2004,45(6):742-750. DOI URL
[14]	Ahire M L, Laxmi S, Walunj P R, et al. Effect of potassium chloride and calcium chloride induced stress on in vitro cultures of Bacopa monnieri (L.) Pennell and accumulation of medicinally important bacoside A[J]. Journal of Plant Biochemistry and Biotechnology, 2014,23(4):366-378. DOI URL
[15]	Ullah S, Kolo Z, Egbichi I, et al. Nitric oxide influences glycine betaine content and ascorbate peroxidase activity in maize[J]. South African Journal of Botany, 2016,105:218-225.
[16]	Farhangi-Abriz S, Ghassemi-Golezani K. How can salicylic acid and jasmonic acid mitigate salt toxicity in soybean plants?[J]. Ecotoxicology and Environmental Safety, 2018,147:1010-1016.
[17]	Reddy A S N, Ali G S, Celesnik H, et al . Coping with stresses: roles of calcium- and calcium/calmodulin-regulated gene expression[J]. The Plant Cell, 2011,23(6):2010-2032.
[18]	Yang S L, Lan S S, Deng F F, et al. Effects of calcium and calmodulin antagonists on chilling stress-induced proline accumulation in Jatropha curcas L.[J]. Journal of Plant Growth Regulation, 2016,35(3):815-826.
[19]	Yang T, Poovaiah B W. Calcium/calmodulin-mediated signal network in plants[J]. Trends in Plant Science, 2003,8(10):505-512. DOI URL
[20]	Nayyar H. Variation in osmoregulation in differentially drought-sensitive wheat genotypes involves calcium[J]. Biologia Plantarum, 2003,47(4):541-547. DOI URL
[21]	Naser Alavi S M, Arvin M J, Manoochehri Kalantari K, et al . Salicylic acid and nitric oxide alleviate osmotic stress in wheat (Triticum aestivum L.) seedlings[J]. Journal of Plant Interactions, 2014,9(1):683-688. DOI URL
[22]	Aghdam M S, Jannatizadeh A, Sheikh-Assadi M, et al. Alleviation of postharvest chilling injury in anthurium cut flowers by salicylic acid treatment[J]. Scientia Horticulturae, 2016,202:70-76. DOI URL
[23]	Shaki F, Maboud H E, Niknam V. Growth enhancement and salt tolerance of safflower (Carthamus tinctorius L.), by salicylic acid[J]. Current Plant Biology, 2018,13:16-22. DOI URL
[24]	Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method [J]. Methods, 2001,25(4):402-408. DOI URL
[25]	Xing D, Wu Y. Photosynthetic response of three climber plant species to osmotic stress induced by polyethylene glycol (PEG) 6000[J]. Acta Physiologiae Plantarum, 2012,34(5):1659-1668. DOI URL
[26]	Farooq M, Basra S M A, Wahid A, et al. Improving the drought tolerance in rice (Oryza sativa L.) by exogenous application of salicylic acid[J]. Journal of Agronomy and Crop Science, 2009,195(4):237-246.
[27]	Li Z G. Synergistic effect of antioxidant system and osmolyte in hydrogen sulfide and salicylic acid crosstalk-induced heat tolerance in maize (Zea mays L.) seedlings[J]. Plant Signaling and Behavior, 2015,10(9):e1051278.
[28]	Hu X L, Wang W, Li C, et al. Cross-talks between Ca ²+/CaM and H₂O₂ in abscisic acid-induced antioxidant defense in leaves of maize plants exposed to water stress [J]. Plant Growth Regulation, 2008,55(3):183.
[29]	Guo H, Zhu N, Deyholos M K, et al. Calcium mobilization in salicylic acid-induced Salvia miltiorrhiza cell cultures and its effect on the accumulation of rosmarinic acid[J]. Applied Biochemistry and Biotechnology, 2015,175(5):2689-2702.
[30]	Niu L, Liao W. Hydrogen peroxide signaling in plant development and abiotic responses: crosstalk with nitric oxide and calcium[J]. Frontiers in Plant Science, 2016,7:230.
[31]	Niu L, Yu J, Liao W, et al. Calcium and calmodulin are involved in nitric oxide-induced adventitious rooting of cucumber under simulated osmotic stress[J]. Frontiers in Plant Science, 2017,8:1684. DOI URL

Ca²⁺/CaM Signaling Involved in Salicylic Acid-Induced Glycine Betaine Accumulation in Jatropha curcas L. under Osmotic Stress

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 31

Related Articles 11

Recommended Articles

Metrics

Comments

[1]	WANG Shihao,ZHU Fangming,SUN Mengli,XU Zijian,JIANG Xuefei,QIAO Fei. Exogenous Betaine Modulating the Tolerance of Osmotic Stress in Watermelon Cells [J]. Chinese Journal of Tropical Crops, 2020, 41(9): 1816-1821.
[2]	SUN Mengli,WANG Shihao,XU Zijian,JIANG Xuefei,SUN Huapeng,QIAO Fei,CONG Hanqing,YU Ping. Exogenous Trehalose Modulating the Tolerance of Osmotic Stress in Watermelon Cells [J]. Chinese Journal of Tropical Crops, 2019, 40(2): 269-274.
[3]	WAN Jifeng, LI Juan, YANG Weihai, ZENG Hui, ZHANG Hanzhou, CHEN Jiezhong. The Effect of Exogenous Regulators on Antioxidant Capacity of Citrus Fruits under the Stress of HighTemperature [J]. Chinese Journal of Tropical Crops, 2018, 39(8): 1548-1552.
[4]	LI Yitong ZHANG Zhizhong Gefu WANG-PRUSKI XI Yupei. Analysis of Autotoxicity-related Genes Expressions in Muskmelon (Cucumis melo L.)Induced by Exogenous Salicylic Acid [J]. Chinese Journal of Tropical Crops, 2017, 38(5): 889-893.
[5]	LONG Xiaojuan LI Yongcheng. Effect of Elicitor on Growth and Cephalotaxus Alkaloids Accumulation of Suspension Cells [J]. Chinese Journal of Tropical Crops, 2015, 36(6): 1125-1130.
[6]	YANG Dongping GAO Zhaoyin LI Min ZHANG Zhengke CHEN Liang YANG Bo ZHAO Chao HU Meijiao. Combination of Salicylic Acid and Ultrasound to Control Postharvest Anthracnose Caused by Colletotrichum gloeosporioides Penz. in Mango Fruit [J]. Chinese Journal of Tropical Crops, 2014, 35(5): 974-979.
[7]	Zhang Jisen, Chen Youqiang, Li Wei Que Youxiong Ye Binyin Chen Rukai Zhang Muqing. Molecular Cloning and Expression of the P5CS Gene from Sugarcane [J]. Chinese Journal of Tropical Crops, 2009, 30(9): 1337-1344.
[8]	Liu Guoqiang Wu Jincheng Zhu Ying Liu Meiqiong Cai Xiaoling Chen Liping. Effect of Salicylic Acid on Some Physiological and Biochemical Indexes in Young Loquat Fruits under Low Temperature Stress [J]. Chinese Journal of Tropical Crops, 2009, 30(3): 254-258.
[9]	Lu Xiaomin Gu Chao . Effect of Exogenous Salicylic Acid on Some Physiological Indexes and Drought Resistance of Glycine max Seedling under Water Stress [J]. Chinese Journal of Tropical Crops, 2008, 29(4): 468-471.
[10]	Ruan Miaohong Wang Wei Qiu Yongxiang Wang Weiying Ke Yuqin Pan Tingguo. Changes of Salicylic Acid and Reactive Oxygen Species Metabolism in Sweet Potato Against Pseudomonas solanacearum#br# [J]. Chinese Journal of Tropical Crops, 2008, 29(1): 14-17.
[11]	Liu Huifang Wu Jilin Hao Bingzhong. Effect of Jasmonic Acid and Other Plant Growth Regulators on Laticifer Differentiation in Hevea brasiliensis [J]. Chinese Journal of Tropical Crops, 2001, 22(3): 6-16.